ID: 1062168771

View in Genome Browser
Species Human (GRCh38)
Location 9:135122615-135122637
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062168771_1062168773 -9 Left 1062168771 9:135122615-135122637 CCAGTCGGGGTGGCCACTTCCCA No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062168771 Original CRISPR TGGGAAGTGGCCACCCCGAC TGG (reversed) Intergenic
No off target data available for this crispr