ID: 1062168773

View in Genome Browser
Species Human (GRCh38)
Location 9:135122629-135122651
Sequence CACTTCCCATCTGCTCTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062168764_1062168773 7 Left 1062168764 9:135122599-135122621 CCTGCACACGCCTCTCCCAGTCG No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data
1062168771_1062168773 -9 Left 1062168771 9:135122615-135122637 CCAGTCGGGGTGGCCACTTCCCA No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data
1062168770_1062168773 -8 Left 1062168770 9:135122614-135122636 CCCAGTCGGGGTGGCCACTTCCC No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data
1062168763_1062168773 8 Left 1062168763 9:135122598-135122620 CCCTGCACACGCCTCTCCCAGTC No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data
1062168769_1062168773 -3 Left 1062168769 9:135122609-135122631 CCTCTCCCAGTCGGGGTGGCCAC No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data
1062168762_1062168773 18 Left 1062168762 9:135122588-135122610 CCTGTCTGTGCCCTGCACACGCC No data
Right 1062168773 9:135122629-135122651 CACTTCCCATCTGCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062168773 Original CRISPR CACTTCCCATCTGCTCTCCT AGG Intergenic
No off target data available for this crispr