ID: 1062169373

View in Genome Browser
Species Human (GRCh38)
Location 9:135126494-135126516
Sequence TGCGGCTCATCAGTGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062169373_1062169382 11 Left 1062169373 9:135126494-135126516 CCCAGGCCCACTGATGAGCCGCA No data
Right 1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG No data
1062169373_1062169383 12 Left 1062169373 9:135126494-135126516 CCCAGGCCCACTGATGAGCCGCA No data
Right 1062169383 9:135126529-135126551 AACCTGGGACTGCCGAGCCTGGG No data
1062169373_1062169380 -4 Left 1062169373 9:135126494-135126516 CCCAGGCCCACTGATGAGCCGCA No data
Right 1062169380 9:135126513-135126535 CGCAGCTCTGGGTGCAAACCTGG No data
1062169373_1062169381 -3 Left 1062169373 9:135126494-135126516 CCCAGGCCCACTGATGAGCCGCA No data
Right 1062169381 9:135126514-135126536 GCAGCTCTGGGTGCAAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062169373 Original CRISPR TGCGGCTCATCAGTGGGCCT GGG (reversed) Intergenic