ID: 1062169375

View in Genome Browser
Species Human (GRCh38)
Location 9:135126500-135126522
Sequence CAGAGCTGCGGCTCATCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062169375_1062169381 -9 Left 1062169375 9:135126500-135126522 CCCACTGATGAGCCGCAGCTCTG No data
Right 1062169381 9:135126514-135126536 GCAGCTCTGGGTGCAAACCTGGG No data
1062169375_1062169380 -10 Left 1062169375 9:135126500-135126522 CCCACTGATGAGCCGCAGCTCTG No data
Right 1062169380 9:135126513-135126535 CGCAGCTCTGGGTGCAAACCTGG No data
1062169375_1062169383 6 Left 1062169375 9:135126500-135126522 CCCACTGATGAGCCGCAGCTCTG No data
Right 1062169383 9:135126529-135126551 AACCTGGGACTGCCGAGCCTGGG No data
1062169375_1062169382 5 Left 1062169375 9:135126500-135126522 CCCACTGATGAGCCGCAGCTCTG No data
Right 1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062169375 Original CRISPR CAGAGCTGCGGCTCATCAGT GGG (reversed) Intergenic
No off target data available for this crispr