ID: 1062169379

View in Genome Browser
Species Human (GRCh38)
Location 9:135126512-135126534
Sequence CAGGTTTGCACCCAGAGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062169379_1062169383 -6 Left 1062169379 9:135126512-135126534 CCGCAGCTCTGGGTGCAAACCTG No data
Right 1062169383 9:135126529-135126551 AACCTGGGACTGCCGAGCCTGGG No data
1062169379_1062169389 28 Left 1062169379 9:135126512-135126534 CCGCAGCTCTGGGTGCAAACCTG No data
Right 1062169389 9:135126563-135126585 CCTGCCTTCAACCGGCCTGCTGG No data
1062169379_1062169382 -7 Left 1062169379 9:135126512-135126534 CCGCAGCTCTGGGTGCAAACCTG No data
Right 1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG No data
1062169379_1062169387 20 Left 1062169379 9:135126512-135126534 CCGCAGCTCTGGGTGCAAACCTG No data
Right 1062169387 9:135126555-135126577 TGCTCTTTCCTGCCTTCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062169379 Original CRISPR CAGGTTTGCACCCAGAGCTG CGG (reversed) Intergenic
No off target data available for this crispr