ID: 1062169382

View in Genome Browser
Species Human (GRCh38)
Location 9:135126528-135126550
Sequence AAACCTGGGACTGCCGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062169373_1062169382 11 Left 1062169373 9:135126494-135126516 CCCAGGCCCACTGATGAGCCGCA No data
Right 1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG No data
1062169375_1062169382 5 Left 1062169375 9:135126500-135126522 CCCACTGATGAGCCGCAGCTCTG No data
Right 1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG No data
1062169374_1062169382 10 Left 1062169374 9:135126495-135126517 CCAGGCCCACTGATGAGCCGCAG No data
Right 1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG No data
1062169379_1062169382 -7 Left 1062169379 9:135126512-135126534 CCGCAGCTCTGGGTGCAAACCTG No data
Right 1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG No data
1062169376_1062169382 4 Left 1062169376 9:135126501-135126523 CCACTGATGAGCCGCAGCTCTGG No data
Right 1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062169382 Original CRISPR AAACCTGGGACTGCCGAGCC TGG Intergenic
No off target data available for this crispr