ID: 1062170230

View in Genome Browser
Species Human (GRCh38)
Location 9:135130842-135130864
Sequence ACTGGAAGGTGCCAGAAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062170230_1062170239 19 Left 1062170230 9:135130842-135130864 CCCGGCTTCTGGCACCTTCCAGT No data
Right 1062170239 9:135130884-135130906 CCATTTCCAGAGCTCCTTGGGGG No data
1062170230_1062170235 16 Left 1062170230 9:135130842-135130864 CCCGGCTTCTGGCACCTTCCAGT No data
Right 1062170235 9:135130881-135130903 CAACCATTTCCAGAGCTCCTTGG No data
1062170230_1062170236 17 Left 1062170230 9:135130842-135130864 CCCGGCTTCTGGCACCTTCCAGT No data
Right 1062170236 9:135130882-135130904 AACCATTTCCAGAGCTCCTTGGG No data
1062170230_1062170237 18 Left 1062170230 9:135130842-135130864 CCCGGCTTCTGGCACCTTCCAGT No data
Right 1062170237 9:135130883-135130905 ACCATTTCCAGAGCTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062170230 Original CRISPR ACTGGAAGGTGCCAGAAGCC GGG (reversed) Intergenic