ID: 1062171497

View in Genome Browser
Species Human (GRCh38)
Location 9:135137356-135137378
Sequence TGGCTGGAAGTTAAAAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062171497_1062171511 11 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171511 9:135137390-135137412 GCCCCCACTGGGGGCAGGGAGGG No data
1062171497_1062171506 1 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171506 9:135137380-135137402 GGGGATTGAGGCCCCCACTGGGG No data
1062171497_1062171517 18 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG No data
1062171497_1062171519 26 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171519 9:135137405-135137427 AGGGAGGGAGGAAGGAACAAGGG No data
1062171497_1062171510 10 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171510 9:135137389-135137411 GGCCCCCACTGGGGGCAGGGAGG No data
1062171497_1062171515 14 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171515 9:135137393-135137415 CCCACTGGGGGCAGGGAGGGAGG No data
1062171497_1062171505 0 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171505 9:135137379-135137401 TGGGGATTGAGGCCCCCACTGGG No data
1062171497_1062171518 25 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171518 9:135137404-135137426 CAGGGAGGGAGGAAGGAACAAGG No data
1062171497_1062171504 -1 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171504 9:135137378-135137400 ATGGGGATTGAGGCCCCCACTGG No data
1062171497_1062171509 7 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171509 9:135137386-135137408 TGAGGCCCCCACTGGGGGCAGGG No data
1062171497_1062171520 27 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171520 9:135137406-135137428 GGGAGGGAGGAAGGAACAAGGGG No data
1062171497_1062171507 2 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171507 9:135137381-135137403 GGGATTGAGGCCCCCACTGGGGG No data
1062171497_1062171508 6 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171508 9:135137385-135137407 TTGAGGCCCCCACTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062171497 Original CRISPR TGGCTGGAAGTTAAAAAACA AGG (reversed) Intergenic
No off target data available for this crispr