ID: 1062171503

View in Genome Browser
Species Human (GRCh38)
Location 9:135137376-135137398
Sequence AGTGGGGGCCTCAATCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062171503_1062171518 5 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171518 9:135137404-135137426 CAGGGAGGGAGGAAGGAACAAGG No data
1062171503_1062171520 7 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171520 9:135137406-135137428 GGGAGGGAGGAAGGAACAAGGGG No data
1062171503_1062171523 20 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171523 9:135137419-135137441 GAACAAGGGGAAGGGATCTGAGG No data
1062171503_1062171519 6 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171519 9:135137405-135137427 AGGGAGGGAGGAAGGAACAAGGG No data
1062171503_1062171510 -10 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171510 9:135137389-135137411 GGCCCCCACTGGGGGCAGGGAGG No data
1062171503_1062171511 -9 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171511 9:135137390-135137412 GCCCCCACTGGGGGCAGGGAGGG No data
1062171503_1062171517 -2 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG No data
1062171503_1062171521 11 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171521 9:135137410-135137432 GGGAGGAAGGAACAAGGGGAAGG No data
1062171503_1062171522 12 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171522 9:135137411-135137433 GGAGGAAGGAACAAGGGGAAGGG No data
1062171503_1062171515 -6 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171515 9:135137393-135137415 CCCACTGGGGGCAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062171503 Original CRISPR AGTGGGGGCCTCAATCCCCA TGG (reversed) Intergenic
No off target data available for this crispr