ID: 1062171517

View in Genome Browser
Species Human (GRCh38)
Location 9:135137397-135137419
Sequence CTGGGGGCAGGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062171503_1062171517 -2 Left 1062171503 9:135137376-135137398 CCATGGGGATTGAGGCCCCCACT No data
Right 1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG No data
1062171502_1062171517 2 Left 1062171502 9:135137372-135137394 CCAGCCATGGGGATTGAGGCCCC No data
Right 1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG No data
1062171497_1062171517 18 Left 1062171497 9:135137356-135137378 CCTTGTTTTTTAACTTCCAGCCA No data
Right 1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062171517 Original CRISPR CTGGGGGCAGGGAGGGAGGA AGG Intergenic
No off target data available for this crispr