ID: 1062174305

View in Genome Browser
Species Human (GRCh38)
Location 9:135152527-135152549
Sequence CACCCCCCACAAGAGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062174299_1062174305 3 Left 1062174299 9:135152501-135152523 CCTCTTCCTGGACTTGCAGAACC No data
Right 1062174305 9:135152527-135152549 CACCCCCCACAAGAGGAACTAGG No data
1062174297_1062174305 14 Left 1062174297 9:135152490-135152512 CCTCTGTGCTCCCTCTTCCTGGA No data
Right 1062174305 9:135152527-135152549 CACCCCCCACAAGAGGAACTAGG No data
1062174298_1062174305 4 Left 1062174298 9:135152500-135152522 CCCTCTTCCTGGACTTGCAGAAC No data
Right 1062174305 9:135152527-135152549 CACCCCCCACAAGAGGAACTAGG No data
1062174294_1062174305 22 Left 1062174294 9:135152482-135152504 CCTACATCCCTCTGTGCTCCCTC No data
Right 1062174305 9:135152527-135152549 CACCCCCCACAAGAGGAACTAGG No data
1062174300_1062174305 -3 Left 1062174300 9:135152507-135152529 CCTGGACTTGCAGAACCCACCAC No data
Right 1062174305 9:135152527-135152549 CACCCCCCACAAGAGGAACTAGG No data
1062174295_1062174305 15 Left 1062174295 9:135152489-135152511 CCCTCTGTGCTCCCTCTTCCTGG No data
Right 1062174305 9:135152527-135152549 CACCCCCCACAAGAGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062174305 Original CRISPR CACCCCCCACAAGAGGAACT AGG Intergenic
No off target data available for this crispr