ID: 1062177734

View in Genome Browser
Species Human (GRCh38)
Location 9:135173549-135173571
Sequence CTGGCCCTAAGGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062177728_1062177734 -10 Left 1062177728 9:135173536-135173558 CCCAGCTCCATGGCTGGCCCTAA No data
Right 1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG No data
1062177726_1062177734 -4 Left 1062177726 9:135173530-135173552 CCGGCACCCAGCTCCATGGCTGG No data
Right 1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG No data
1062177722_1062177734 2 Left 1062177722 9:135173524-135173546 CCCCTACCGGCACCCAGCTCCAT No data
Right 1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG No data
1062177723_1062177734 1 Left 1062177723 9:135173525-135173547 CCCTACCGGCACCCAGCTCCATG No data
Right 1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG No data
1062177724_1062177734 0 Left 1062177724 9:135173526-135173548 CCTACCGGCACCCAGCTCCATGG No data
Right 1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG No data
1062177720_1062177734 22 Left 1062177720 9:135173504-135173526 CCACACACAGTGGTTCTCAGCCC No data
Right 1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062177734 Original CRISPR CTGGCCCTAAGGAGGGCAGC TGG Intergenic
No off target data available for this crispr