ID: 1062177919

View in Genome Browser
Species Human (GRCh38)
Location 9:135174598-135174620
Sequence AGTCAGGGGCCAGCGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062177919_1062177933 20 Left 1062177919 9:135174598-135174620 CCCTCTGCCGCTGGCCCCTGACT No data
Right 1062177933 9:135174641-135174663 AGGGAGGCCCATGGGATGATTGG No data
1062177919_1062177929 1 Left 1062177919 9:135174598-135174620 CCCTCTGCCGCTGGCCCCTGACT No data
Right 1062177929 9:135174622-135174644 TTAAGGCTGCTGCTCTGGGAGGG No data
1062177919_1062177932 12 Left 1062177919 9:135174598-135174620 CCCTCTGCCGCTGGCCCCTGACT No data
Right 1062177932 9:135174633-135174655 GCTCTGGGAGGGAGGCCCATGGG No data
1062177919_1062177926 -4 Left 1062177919 9:135174598-135174620 CCCTCTGCCGCTGGCCCCTGACT No data
Right 1062177926 9:135174617-135174639 GACTCTTAAGGCTGCTGCTCTGG No data
1062177919_1062177927 -3 Left 1062177919 9:135174598-135174620 CCCTCTGCCGCTGGCCCCTGACT No data
Right 1062177927 9:135174618-135174640 ACTCTTAAGGCTGCTGCTCTGGG No data
1062177919_1062177930 4 Left 1062177919 9:135174598-135174620 CCCTCTGCCGCTGGCCCCTGACT No data
Right 1062177930 9:135174625-135174647 AGGCTGCTGCTCTGGGAGGGAGG No data
1062177919_1062177931 11 Left 1062177919 9:135174598-135174620 CCCTCTGCCGCTGGCCCCTGACT No data
Right 1062177931 9:135174632-135174654 TGCTCTGGGAGGGAGGCCCATGG No data
1062177919_1062177928 0 Left 1062177919 9:135174598-135174620 CCCTCTGCCGCTGGCCCCTGACT No data
Right 1062177928 9:135174621-135174643 CTTAAGGCTGCTGCTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062177919 Original CRISPR AGTCAGGGGCCAGCGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr