ID: 1062178191

View in Genome Browser
Species Human (GRCh38)
Location 9:135175949-135175971
Sequence AAGAAGCCATGGTTTCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062178191_1062178194 -2 Left 1062178191 9:135175949-135175971 CCCAGTGGAAACCATGGCTTCTT No data
Right 1062178194 9:135175970-135175992 TTTTCCATCCTTCTTTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062178191 Original CRISPR AAGAAGCCATGGTTTCCACT GGG (reversed) Intergenic
No off target data available for this crispr