ID: 1062178909

View in Genome Browser
Species Human (GRCh38)
Location 9:135180160-135180182
Sequence CAGTGACAACAGGAGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062178903_1062178909 1 Left 1062178903 9:135180136-135180158 CCCGGCCTTGGGCCATCTGGCTC No data
Right 1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG No data
1062178904_1062178909 0 Left 1062178904 9:135180137-135180159 CCGGCCTTGGGCCATCTGGCTCT No data
Right 1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG No data
1062178905_1062178909 -4 Left 1062178905 9:135180141-135180163 CCTTGGGCCATCTGGCTCTCAGT No data
Right 1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG No data
1062178901_1062178909 11 Left 1062178901 9:135180126-135180148 CCTTGGCAAGCCCGGCCTTGGGC No data
Right 1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG No data
1062178898_1062178909 17 Left 1062178898 9:135180120-135180142 CCATGTCCTTGGCAAGCCCGGCC No data
Right 1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062178909 Original CRISPR CAGTGACAACAGGAGGAGTG AGG Intergenic
No off target data available for this crispr