ID: 1062179633

View in Genome Browser
Species Human (GRCh38)
Location 9:135184336-135184358
Sequence GCCCGGAGGCTGCTGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062179633_1062179640 16 Left 1062179633 9:135184336-135184358 CCACTGCCCAGCAGCCTCCGGGC No data
Right 1062179640 9:135184375-135184397 TGACTCTCCAGCAGCCGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062179633 Original CRISPR GCCCGGAGGCTGCTGGGCAG TGG (reversed) Intergenic
No off target data available for this crispr