ID: 1062181111

View in Genome Browser
Species Human (GRCh38)
Location 9:135191779-135191801
Sequence AGTGCCCGAGGGTGACCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062181102_1062181111 -5 Left 1062181102 9:135191761-135191783 CCAGGGCCTGATGGTCCCAGTGC No data
Right 1062181111 9:135191779-135191801 AGTGCCCGAGGGTGACCTGGGGG No data
1062181097_1062181111 21 Left 1062181097 9:135191735-135191757 CCATCTCTTCAAAGAGGACAGTC No data
Right 1062181111 9:135191779-135191801 AGTGCCCGAGGGTGACCTGGGGG No data
1062181101_1062181111 -4 Left 1062181101 9:135191760-135191782 CCCAGGGCCTGATGGTCCCAGTG No data
Right 1062181111 9:135191779-135191801 AGTGCCCGAGGGTGACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062181111 Original CRISPR AGTGCCCGAGGGTGACCTGG GGG Intergenic