ID: 1062181938

View in Genome Browser
Species Human (GRCh38)
Location 9:135195585-135195607
Sequence GCCCAGGGTGACACGCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062181932_1062181938 -2 Left 1062181932 9:135195564-135195586 CCAACCACAGAATCAGGCGCAGC No data
Right 1062181938 9:135195585-135195607 GCCCAGGGTGACACGCGCTGGGG No data
1062181929_1062181938 27 Left 1062181929 9:135195535-135195557 CCTTGAATGACTGGGCACGGAAG No data
Right 1062181938 9:135195585-135195607 GCCCAGGGTGACACGCGCTGGGG No data
1062181933_1062181938 -6 Left 1062181933 9:135195568-135195590 CCACAGAATCAGGCGCAGCCCAG No data
Right 1062181938 9:135195585-135195607 GCCCAGGGTGACACGCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062181938 Original CRISPR GCCCAGGGTGACACGCGCTG GGG Intergenic
No off target data available for this crispr