ID: 1062182617

View in Genome Browser
Species Human (GRCh38)
Location 9:135198718-135198740
Sequence GCTTGCTCTCCCTTTGGTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062182617_1062182623 13 Left 1062182617 9:135198718-135198740 CCGACACCAAAGGGAGAGCAAGC No data
Right 1062182623 9:135198754-135198776 CACTGCAGTCCATAACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062182617 Original CRISPR GCTTGCTCTCCCTTTGGTGT CGG (reversed) Intergenic
No off target data available for this crispr