ID: 1062187053

View in Genome Browser
Species Human (GRCh38)
Location 9:135223779-135223801
Sequence AATGAAGGAGTCACCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062187048_1062187053 -2 Left 1062187048 9:135223758-135223780 CCGAGCAAGCAGGGAGGCACTAA No data
Right 1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG No data
1062187047_1062187053 -1 Left 1062187047 9:135223757-135223779 CCCGAGCAAGCAGGGAGGCACTA No data
Right 1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG No data
1062187043_1062187053 17 Left 1062187043 9:135223739-135223761 CCTGGAGGGCGGTGCAGACCCGA No data
Right 1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062187053 Original CRISPR AATGAAGGAGTCACCCCAGG GGG Intergenic
No off target data available for this crispr