ID: 1062187397

View in Genome Browser
Species Human (GRCh38)
Location 9:135225168-135225190
Sequence CACCGTTTGCTCCCTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062187397_1062187401 -8 Left 1062187397 9:135225168-135225190 CCTTTGTCAGGGAGCAAACGGTG No data
Right 1062187401 9:135225183-135225205 AAACGGTGCAGGCTGGCAGGCGG No data
1062187397_1062187402 -5 Left 1062187397 9:135225168-135225190 CCTTTGTCAGGGAGCAAACGGTG No data
Right 1062187402 9:135225186-135225208 CGGTGCAGGCTGGCAGGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062187397 Original CRISPR CACCGTTTGCTCCCTGACAA AGG (reversed) Intergenic