ID: 1062188433

View in Genome Browser
Species Human (GRCh38)
Location 9:135231095-135231117
Sequence GCATGAGGGGGGCTCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062188433_1062188443 21 Left 1062188433 9:135231095-135231117 CCCTGCAGGAGCCCCCCTCATGC No data
Right 1062188443 9:135231139-135231161 GCCCCGGTCCTGCTGCCTGGAGG No data
1062188433_1062188442 18 Left 1062188433 9:135231095-135231117 CCCTGCAGGAGCCCCCCTCATGC No data
Right 1062188442 9:135231136-135231158 TGAGCCCCGGTCCTGCTGCCTGG No data
1062188433_1062188441 5 Left 1062188433 9:135231095-135231117 CCCTGCAGGAGCCCCCCTCATGC No data
Right 1062188441 9:135231123-135231145 GAGAGTTTTCAGATGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062188433 Original CRISPR GCATGAGGGGGGCTCCTGCA GGG (reversed) Intergenic
No off target data available for this crispr