ID: 1062188965

View in Genome Browser
Species Human (GRCh38)
Location 9:135237209-135237231
Sequence CACATTAAGAAGAATGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062188962_1062188965 20 Left 1062188962 9:135237166-135237188 CCATCAATAAGGGAACAAGTCCA No data
Right 1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG No data
1062188960_1062188965 28 Left 1062188960 9:135237158-135237180 CCACATGCCCATCAATAAGGGAA No data
Right 1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG No data
1062188963_1062188965 0 Left 1062188963 9:135237186-135237208 CCATAAAAATACAAAAGCTGCTT No data
Right 1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG No data
1062188961_1062188965 21 Left 1062188961 9:135237165-135237187 CCCATCAATAAGGGAACAAGTCC No data
Right 1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062188965 Original CRISPR CACATTAAGAAGAATGAGGC CGG Intergenic
No off target data available for this crispr