ID: 1062189515

View in Genome Browser
Species Human (GRCh38)
Location 9:135240633-135240655
Sequence CCTTGGGAATAGTCGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062189515_1062189524 1 Left 1062189515 9:135240633-135240655 CCAATGTCCGACTATTCCCAAGG No data
Right 1062189524 9:135240657-135240679 CTTCATCCTCATGGGCGACTGGG No data
1062189515_1062189526 7 Left 1062189515 9:135240633-135240655 CCAATGTCCGACTATTCCCAAGG No data
Right 1062189526 9:135240663-135240685 CCTCATGGGCGACTGGGAACTGG No data
1062189515_1062189527 22 Left 1062189515 9:135240633-135240655 CCAATGTCCGACTATTCCCAAGG No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data
1062189515_1062189520 -7 Left 1062189515 9:135240633-135240655 CCAATGTCCGACTATTCCCAAGG No data
Right 1062189520 9:135240649-135240671 CCCAAGGCCTTCATCCTCATGGG No data
1062189515_1062189518 -8 Left 1062189515 9:135240633-135240655 CCAATGTCCGACTATTCCCAAGG No data
Right 1062189518 9:135240648-135240670 TCCCAAGGCCTTCATCCTCATGG No data
1062189515_1062189523 0 Left 1062189515 9:135240633-135240655 CCAATGTCCGACTATTCCCAAGG No data
Right 1062189523 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062189515 Original CRISPR CCTTGGGAATAGTCGGACAT TGG (reversed) Intergenic