ID: 1062189523

View in Genome Browser
Species Human (GRCh38)
Location 9:135240656-135240678
Sequence CCTTCATCCTCATGGGCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062189514_1062189523 1 Left 1062189514 9:135240632-135240654 CCCAATGTCCGACTATTCCCAAG No data
Right 1062189523 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data
1062189517_1062189523 -7 Left 1062189517 9:135240640-135240662 CCGACTATTCCCAAGGCCTTCAT No data
Right 1062189523 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data
1062189515_1062189523 0 Left 1062189515 9:135240633-135240655 CCAATGTCCGACTATTCCCAAGG No data
Right 1062189523 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data
1062189512_1062189523 16 Left 1062189512 9:135240617-135240639 CCATCTCTGCTCCATCCCAATGT No data
Right 1062189523 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data
1062189511_1062189523 23 Left 1062189511 9:135240610-135240632 CCAATGTCCATCTCTGCTCCATC No data
Right 1062189523 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data
1062189513_1062189523 5 Left 1062189513 9:135240628-135240650 CCATCCCAATGTCCGACTATTCC No data
Right 1062189523 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data
1062189510_1062189523 24 Left 1062189510 9:135240609-135240631 CCCAATGTCCATCTCTGCTCCAT No data
Right 1062189523 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062189523 Original CRISPR CCTTCATCCTCATGGGCGAC TGG Intergenic