ID: 1062189527

View in Genome Browser
Species Human (GRCh38)
Location 9:135240678-135240700
Sequence GGAACTGGTGTGATTCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062189515_1062189527 22 Left 1062189515 9:135240633-135240655 CCAATGTCCGACTATTCCCAAGG No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data
1062189517_1062189527 15 Left 1062189517 9:135240640-135240662 CCGACTATTCCCAAGGCCTTCAT No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data
1062189522_1062189527 -1 Left 1062189522 9:135240656-135240678 CCTTCATCCTCATGGGCGACTGG No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data
1062189521_1062189527 5 Left 1062189521 9:135240650-135240672 CCAAGGCCTTCATCCTCATGGGC No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data
1062189514_1062189527 23 Left 1062189514 9:135240632-135240654 CCCAATGTCCGACTATTCCCAAG No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data
1062189525_1062189527 -8 Left 1062189525 9:135240663-135240685 CCTCATGGGCGACTGGGAACTGG No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data
1062189519_1062189527 6 Left 1062189519 9:135240649-135240671 CCCAAGGCCTTCATCCTCATGGG No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data
1062189513_1062189527 27 Left 1062189513 9:135240628-135240650 CCATCCCAATGTCCGACTATTCC No data
Right 1062189527 9:135240678-135240700 GGAACTGGTGTGATTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062189527 Original CRISPR GGAACTGGTGTGATTCAGAA AGG Intergenic