ID: 1062189812

View in Genome Browser
Species Human (GRCh38)
Location 9:135242229-135242251
Sequence CTGCCTGGGTGGCCTTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062189812_1062189826 29 Left 1062189812 9:135242229-135242251 CCCCTCCAAGGCCACCCAGGCAG No data
Right 1062189826 9:135242281-135242303 TCCCCTTCCCCGCAGCCTCAGGG No data
1062189812_1062189825 28 Left 1062189812 9:135242229-135242251 CCCCTCCAAGGCCACCCAGGCAG No data
Right 1062189825 9:135242280-135242302 GTCCCCTTCCCCGCAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062189812 Original CRISPR CTGCCTGGGTGGCCTTGGAG GGG (reversed) Intergenic
No off target data available for this crispr