ID: 1062190153

View in Genome Browser
Species Human (GRCh38)
Location 9:135243831-135243853
Sequence GCCCACTGCCCTAGGCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190153_1062190166 29 Left 1062190153 9:135243831-135243853 CCAATGGGCCTAGGGCAGTGGGC No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190153_1062190161 16 Left 1062190153 9:135243831-135243853 CCAATGGGCCTAGGGCAGTGGGC No data
Right 1062190161 9:135243870-135243892 CCTGTCTAGACCCCGCCTGGCGG No data
1062190153_1062190162 17 Left 1062190153 9:135243831-135243853 CCAATGGGCCTAGGGCAGTGGGC No data
Right 1062190162 9:135243871-135243893 CTGTCTAGACCCCGCCTGGCGGG No data
1062190153_1062190158 13 Left 1062190153 9:135243831-135243853 CCAATGGGCCTAGGGCAGTGGGC No data
Right 1062190158 9:135243867-135243889 CACCCTGTCTAGACCCCGCCTGG No data
1062190153_1062190167 30 Left 1062190153 9:135243831-135243853 CCAATGGGCCTAGGGCAGTGGGC No data
Right 1062190167 9:135243884-135243906 GCCTGGCGGGCAGCTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190153 Original CRISPR GCCCACTGCCCTAGGCCCAT TGG (reversed) Intergenic