ID: 1062190156

View in Genome Browser
Species Human (GRCh38)
Location 9:135243863-135243885
Sequence GCGGGGTCTAGACAGGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190156_1062190169 -1 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190169 9:135243885-135243907 CCTGGCGGGCAGCTCTGCTGGGG No data
1062190156_1062190172 9 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190172 9:135243895-135243917 AGCTCTGCTGGGGAAGCCTGGGG No data
1062190156_1062190178 28 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190178 9:135243914-135243936 GGGGCCCCTGTGCGTGGTGGGGG No data
1062190156_1062190167 -2 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190167 9:135243884-135243906 GCCTGGCGGGCAGCTCTGCTGGG No data
1062190156_1062190176 26 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190176 9:135243912-135243934 CTGGGGCCCCTGTGCGTGGTGGG No data
1062190156_1062190166 -3 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190156_1062190173 22 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190173 9:135243908-135243930 AAGCCTGGGGCCCCTGTGCGTGG No data
1062190156_1062190177 27 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190156_1062190175 25 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190175 9:135243911-135243933 CCTGGGGCCCCTGTGCGTGGTGG No data
1062190156_1062190170 7 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data
1062190156_1062190171 8 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190156 Original CRISPR GCGGGGTCTAGACAGGGTGG TGG (reversed) Intergenic
No off target data available for this crispr