ID: 1062190157

View in Genome Browser
Species Human (GRCh38)
Location 9:135243866-135243888
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190157_1062190175 22 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190175 9:135243911-135243933 CCTGGGGCCCCTGTGCGTGGTGG No data
1062190157_1062190178 25 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190178 9:135243914-135243936 GGGGCCCCTGTGCGTGGTGGGGG No data
1062190157_1062190171 5 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data
1062190157_1062190170 4 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data
1062190157_1062190173 19 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190173 9:135243908-135243930 AAGCCTGGGGCCCCTGTGCGTGG No data
1062190157_1062190172 6 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190172 9:135243895-135243917 AGCTCTGCTGGGGAAGCCTGGGG No data
1062190157_1062190169 -4 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190169 9:135243885-135243907 CCTGGCGGGCAGCTCTGCTGGGG No data
1062190157_1062190166 -6 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190157_1062190177 24 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190157_1062190167 -5 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190167 9:135243884-135243906 GCCTGGCGGGCAGCTCTGCTGGG No data
1062190157_1062190176 23 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190176 9:135243912-135243934 CTGGGGCCCCTGTGCGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190157 Original CRISPR CAGGCGGGGTCTAGACAGGG TGG (reversed) Intergenic