ID: 1062190158

View in Genome Browser
Species Human (GRCh38)
Location 9:135243867-135243889
Sequence CACCCTGTCTAGACCCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190154_1062190158 5 Left 1062190154 9:135243839-135243861 CCTAGGGCAGTGGGCGACTGCCA No data
Right 1062190158 9:135243867-135243889 CACCCTGTCTAGACCCCGCCTGG No data
1062190153_1062190158 13 Left 1062190153 9:135243831-135243853 CCAATGGGCCTAGGGCAGTGGGC No data
Right 1062190158 9:135243867-135243889 CACCCTGTCTAGACCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190158 Original CRISPR CACCCTGTCTAGACCCCGCC TGG Intergenic
No off target data available for this crispr