ID: 1062190161

View in Genome Browser
Species Human (GRCh38)
Location 9:135243870-135243892
Sequence CCTGTCTAGACCCCGCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190153_1062190161 16 Left 1062190153 9:135243831-135243853 CCAATGGGCCTAGGGCAGTGGGC No data
Right 1062190161 9:135243870-135243892 CCTGTCTAGACCCCGCCTGGCGG No data
1062190154_1062190161 8 Left 1062190154 9:135243839-135243861 CCTAGGGCAGTGGGCGACTGCCA No data
Right 1062190161 9:135243870-135243892 CCTGTCTAGACCCCGCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190161 Original CRISPR CCTGTCTAGACCCCGCCTGG CGG Intergenic
No off target data available for this crispr