ID: 1062190163

View in Genome Browser
Species Human (GRCh38)
Location 9:135243880-135243902
Sequence GCAGAGCTGCCCGCCAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190163_1062190175 8 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190175 9:135243911-135243933 CCTGGGGCCCCTGTGCGTGGTGG No data
1062190163_1062190173 5 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190173 9:135243908-135243930 AAGCCTGGGGCCCCTGTGCGTGG No data
1062190163_1062190178 11 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190178 9:135243914-135243936 GGGGCCCCTGTGCGTGGTGGGGG No data
1062190163_1062190172 -8 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190172 9:135243895-135243917 AGCTCTGCTGGGGAAGCCTGGGG No data
1062190163_1062190170 -10 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data
1062190163_1062190176 9 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190176 9:135243912-135243934 CTGGGGCCCCTGTGCGTGGTGGG No data
1062190163_1062190177 10 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190163_1062190171 -9 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190163 Original CRISPR GCAGAGCTGCCCGCCAGGCG GGG (reversed) Intergenic