ID: 1062190165

View in Genome Browser
Species Human (GRCh38)
Location 9:135243882-135243904
Sequence CAGCAGAGCTGCCCGCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190165_1062190178 9 Left 1062190165 9:135243882-135243904 CCGCCTGGCGGGCAGCTCTGCTG No data
Right 1062190178 9:135243914-135243936 GGGGCCCCTGTGCGTGGTGGGGG No data
1062190165_1062190173 3 Left 1062190165 9:135243882-135243904 CCGCCTGGCGGGCAGCTCTGCTG No data
Right 1062190173 9:135243908-135243930 AAGCCTGGGGCCCCTGTGCGTGG No data
1062190165_1062190177 8 Left 1062190165 9:135243882-135243904 CCGCCTGGCGGGCAGCTCTGCTG No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190165_1062190176 7 Left 1062190165 9:135243882-135243904 CCGCCTGGCGGGCAGCTCTGCTG No data
Right 1062190176 9:135243912-135243934 CTGGGGCCCCTGTGCGTGGTGGG No data
1062190165_1062190175 6 Left 1062190165 9:135243882-135243904 CCGCCTGGCGGGCAGCTCTGCTG No data
Right 1062190175 9:135243911-135243933 CCTGGGGCCCCTGTGCGTGGTGG No data
1062190165_1062190172 -10 Left 1062190165 9:135243882-135243904 CCGCCTGGCGGGCAGCTCTGCTG No data
Right 1062190172 9:135243895-135243917 AGCTCTGCTGGGGAAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190165 Original CRISPR CAGCAGAGCTGCCCGCCAGG CGG (reversed) Intergenic