ID: 1062190166

View in Genome Browser
Species Human (GRCh38)
Location 9:135243883-135243905
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190160_1062190166 -10 Left 1062190160 9:135243870-135243892 CCTGTCTAGACCCCGCCTGGCGG No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190157_1062190166 -6 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190154_1062190166 21 Left 1062190154 9:135243839-135243861 CCTAGGGCAGTGGGCGACTGCCA No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190159_1062190166 -9 Left 1062190159 9:135243869-135243891 CCCTGTCTAGACCCCGCCTGGCG No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190155_1062190166 1 Left 1062190155 9:135243859-135243881 CCATCCACCACCCTGTCTAGACC No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190156_1062190166 -3 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data
1062190153_1062190166 29 Left 1062190153 9:135243831-135243853 CCAATGGGCCTAGGGCAGTGGGC No data
Right 1062190166 9:135243883-135243905 CGCCTGGCGGGCAGCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190166 Original CRISPR CGCCTGGCGGGCAGCTCTGC TGG Intergenic