ID: 1062190170

View in Genome Browser
Species Human (GRCh38)
Location 9:135243893-135243915
Sequence GCAGCTCTGCTGGGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190155_1062190170 11 Left 1062190155 9:135243859-135243881 CCATCCACCACCCTGTCTAGACC No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data
1062190160_1062190170 0 Left 1062190160 9:135243870-135243892 CCTGTCTAGACCCCGCCTGGCGG No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data
1062190156_1062190170 7 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data
1062190163_1062190170 -10 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data
1062190157_1062190170 4 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data
1062190159_1062190170 1 Left 1062190159 9:135243869-135243891 CCCTGTCTAGACCCCGCCTGGCG No data
Right 1062190170 9:135243893-135243915 GCAGCTCTGCTGGGGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190170 Original CRISPR GCAGCTCTGCTGGGGAAGCC TGG Intergenic
No off target data available for this crispr