ID: 1062190171

View in Genome Browser
Species Human (GRCh38)
Location 9:135243894-135243916
Sequence CAGCTCTGCTGGGGAAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190164_1062190171 -10 Left 1062190164 9:135243881-135243903 CCCGCCTGGCGGGCAGCTCTGCT No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data
1062190157_1062190171 5 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data
1062190155_1062190171 12 Left 1062190155 9:135243859-135243881 CCATCCACCACCCTGTCTAGACC No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data
1062190156_1062190171 8 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data
1062190163_1062190171 -9 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data
1062190160_1062190171 1 Left 1062190160 9:135243870-135243892 CCTGTCTAGACCCCGCCTGGCGG No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data
1062190159_1062190171 2 Left 1062190159 9:135243869-135243891 CCCTGTCTAGACCCCGCCTGGCG No data
Right 1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190171 Original CRISPR CAGCTCTGCTGGGGAAGCCT GGG Intergenic