ID: 1062190177

View in Genome Browser
Species Human (GRCh38)
Location 9:135243913-135243935
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190160_1062190177 20 Left 1062190160 9:135243870-135243892 CCTGTCTAGACCCCGCCTGGCGG No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190156_1062190177 27 Left 1062190156 9:135243863-135243885 CCACCACCCTGTCTAGACCCCGC No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190168_1062190177 5 Left 1062190168 9:135243885-135243907 CCTGGCGGGCAGCTCTGCTGGGG No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190165_1062190177 8 Left 1062190165 9:135243882-135243904 CCGCCTGGCGGGCAGCTCTGCTG No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190164_1062190177 9 Left 1062190164 9:135243881-135243903 CCCGCCTGGCGGGCAGCTCTGCT No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190159_1062190177 21 Left 1062190159 9:135243869-135243891 CCCTGTCTAGACCCCGCCTGGCG No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190157_1062190177 24 Left 1062190157 9:135243866-135243888 CCACCCTGTCTAGACCCCGCCTG No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data
1062190163_1062190177 10 Left 1062190163 9:135243880-135243902 CCCCGCCTGGCGGGCAGCTCTGC No data
Right 1062190177 9:135243913-135243935 TGGGGCCCCTGTGCGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190177 Original CRISPR TGGGGCCCCTGTGCGTGGTG GGG Intergenic
No off target data available for this crispr