ID: 1062190644

View in Genome Browser
Species Human (GRCh38)
Location 9:135246243-135246265
Sequence ATGAATAAACGGATAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190640_1062190644 -7 Left 1062190640 9:135246227-135246249 CCATCTCCCTGGGTAAATGAATA 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1062190644 9:135246243-135246265 ATGAATAAACGGATAATCAATGG No data
1062190638_1062190644 2 Left 1062190638 9:135246218-135246240 CCCGATGTTCCATCTCCCTGGGT 0: 1
1: 0
2: 0
3: 16
4: 234
Right 1062190644 9:135246243-135246265 ATGAATAAACGGATAATCAATGG No data
1062190639_1062190644 1 Left 1062190639 9:135246219-135246241 CCGATGTTCCATCTCCCTGGGTA 0: 1
1: 0
2: 2
3: 11
4: 140
Right 1062190644 9:135246243-135246265 ATGAATAAACGGATAATCAATGG No data
1062190636_1062190644 3 Left 1062190636 9:135246217-135246239 CCCCGATGTTCCATCTCCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1062190644 9:135246243-135246265 ATGAATAAACGGATAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190644 Original CRISPR ATGAATAAACGGATAATCAA TGG Intergenic
No off target data available for this crispr