ID: 1062190813

View in Genome Browser
Species Human (GRCh38)
Location 9:135246985-135247007
Sequence GCTCCACAGGCCTCGGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062190809_1062190813 -8 Left 1062190809 9:135246970-135246992 CCTGAGGCACGTGAAGCTCCACA No data
Right 1062190813 9:135246985-135247007 GCTCCACAGGCCTCGGGTGATGG No data
1062190808_1062190813 -7 Left 1062190808 9:135246969-135246991 CCCTGAGGCACGTGAAGCTCCAC No data
Right 1062190813 9:135246985-135247007 GCTCCACAGGCCTCGGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062190813 Original CRISPR GCTCCACAGGCCTCGGGTGA TGG Intergenic
No off target data available for this crispr