ID: 1062192701

View in Genome Browser
Species Human (GRCh38)
Location 9:135256001-135256023
Sequence AAGAGCAAAGAGACGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062192701_1062192708 14 Left 1062192701 9:135256001-135256023 CCTCCATCCGTCTCTTTGCTCTT No data
Right 1062192708 9:135256038-135256060 ACATGCCCCTCTCTCTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062192701 Original CRISPR AAGAGCAAAGAGACGGATGG AGG (reversed) Intergenic
No off target data available for this crispr