ID: 1062196233

View in Genome Browser
Species Human (GRCh38)
Location 9:135275703-135275725
Sequence TCCTCCTCAGGCCTGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062196233_1062196239 11 Left 1062196233 9:135275703-135275725 CCTTCCTGCAGGCCTGAGGAGGA No data
Right 1062196239 9:135275737-135275759 TTGTTCTCCCAGGCATGACTTGG No data
1062196233_1062196242 20 Left 1062196233 9:135275703-135275725 CCTTCCTGCAGGCCTGAGGAGGA No data
Right 1062196242 9:135275746-135275768 CAGGCATGACTTGGCAGCGACGG No data
1062196233_1062196237 1 Left 1062196233 9:135275703-135275725 CCTTCCTGCAGGCCTGAGGAGGA No data
Right 1062196237 9:135275727-135275749 GTGCCAGGACTTGTTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062196233 Original CRISPR TCCTCCTCAGGCCTGCAGGA AGG (reversed) Intergenic