ID: 1062197107

View in Genome Browser
Species Human (GRCh38)
Location 9:135280411-135280433
Sequence GAGGCTCTGTACCATGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197105_1062197107 -9 Left 1062197105 9:135280397-135280419 CCAGCTCAGAGCGGGAGGCTCTG No data
Right 1062197107 9:135280411-135280433 GAGGCTCTGTACCATGTGGCTGG No data
1062197103_1062197107 -2 Left 1062197103 9:135280390-135280412 CCGGATGCCAGCTCAGAGCGGGA No data
Right 1062197107 9:135280411-135280433 GAGGCTCTGTACCATGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197107 Original CRISPR GAGGCTCTGTACCATGTGGC TGG Intergenic
No off target data available for this crispr