ID: 1062197120

View in Genome Browser
Species Human (GRCh38)
Location 9:135280470-135280492
Sequence GAGGCTCTGTACCATGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197112_1062197120 13 Left 1062197112 9:135280434-135280456 CCATACCCTGGGCTCTGTTGGCG No data
Right 1062197120 9:135280470-135280492 GAGGCTCTGTACCATGTGGCTGG No data
1062197108_1062197120 25 Left 1062197108 9:135280422-135280444 CCATGTGGCTGGCCATACCCTGG No data
Right 1062197120 9:135280470-135280492 GAGGCTCTGTACCATGTGGCTGG No data
1062197114_1062197120 8 Left 1062197114 9:135280439-135280461 CCCTGGGCTCTGTTGGCGAGGTC No data
Right 1062197120 9:135280470-135280492 GAGGCTCTGTACCATGTGGCTGG No data
1062197115_1062197120 7 Left 1062197115 9:135280440-135280462 CCTGGGCTCTGTTGGCGAGGTCT No data
Right 1062197120 9:135280470-135280492 GAGGCTCTGTACCATGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197120 Original CRISPR GAGGCTCTGTACCATGTGGC TGG Intergenic
No off target data available for this crispr