ID: 1062197977

View in Genome Browser
Species Human (GRCh38)
Location 9:135285119-135285141
Sequence GTGCACATGCCTGTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197977_1062197979 -3 Left 1062197977 9:135285119-135285141 CCCACACACACAGGCATGTGCAC No data
Right 1062197979 9:135285139-135285161 CACACGTGACACGCGTCCCCAGG No data
1062197977_1062197983 28 Left 1062197977 9:135285119-135285141 CCCACACACACAGGCATGTGCAC No data
Right 1062197983 9:135285170-135285192 TGCACACGCATCCCCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197977 Original CRISPR GTGCACATGCCTGTGTGTGT GGG (reversed) Intergenic