ID: 1062197980

View in Genome Browser
Species Human (GRCh38)
Location 9:135285155-135285177
Sequence CGTGTGCACGTGTGTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197980_1062197988 21 Left 1062197980 9:135285155-135285177 CCCCAGGCACACACGTGCACACG No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data
1062197980_1062197983 -8 Left 1062197980 9:135285155-135285177 CCCCAGGCACACACGTGCACACG No data
Right 1062197983 9:135285170-135285192 TGCACACGCATCCCCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197980 Original CRISPR CGTGTGCACGTGTGTGCCTG GGG (reversed) Intergenic