ID: 1062197981

View in Genome Browser
Species Human (GRCh38)
Location 9:135285156-135285178
Sequence GCGTGTGCACGTGTGTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197981_1062197988 20 Left 1062197981 9:135285156-135285178 CCCAGGCACACACGTGCACACGC No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data
1062197981_1062197983 -9 Left 1062197981 9:135285156-135285178 CCCAGGCACACACGTGCACACGC No data
Right 1062197983 9:135285170-135285192 TGCACACGCATCCCCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197981 Original CRISPR GCGTGTGCACGTGTGTGCCT GGG (reversed) Intergenic
No off target data available for this crispr