ID: 1062197982 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:135285157-135285179 |
| Sequence | TGCGTGTGCACGTGTGTGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062197982_1062197983 | -10 | Left | 1062197982 | 9:135285157-135285179 | CCAGGCACACACGTGCACACGCA | No data | ||
| Right | 1062197983 | 9:135285170-135285192 | TGCACACGCATCCCCCACACAGG | No data | ||||
| 1062197982_1062197988 | 19 | Left | 1062197982 | 9:135285157-135285179 | CCAGGCACACACGTGCACACGCA | No data | ||
| Right | 1062197988 | 9:135285199-135285221 | CACACGTGACACGCGTCCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062197982 | Original CRISPR | TGCGTGTGCACGTGTGTGCC TGG (reversed) | Intergenic | ||