ID: 1062197983

View in Genome Browser
Species Human (GRCh38)
Location 9:135285170-135285192
Sequence TGCACACGCATCCCCCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197981_1062197983 -9 Left 1062197981 9:135285156-135285178 CCCAGGCACACACGTGCACACGC No data
Right 1062197983 9:135285170-135285192 TGCACACGCATCCCCCACACAGG No data
1062197977_1062197983 28 Left 1062197977 9:135285119-135285141 CCCACACACACAGGCATGTGCAC No data
Right 1062197983 9:135285170-135285192 TGCACACGCATCCCCCACACAGG No data
1062197980_1062197983 -8 Left 1062197980 9:135285155-135285177 CCCCAGGCACACACGTGCACACG No data
Right 1062197983 9:135285170-135285192 TGCACACGCATCCCCCACACAGG No data
1062197978_1062197983 27 Left 1062197978 9:135285120-135285142 CCACACACACAGGCATGTGCACA No data
Right 1062197983 9:135285170-135285192 TGCACACGCATCCCCCACACAGG No data
1062197982_1062197983 -10 Left 1062197982 9:135285157-135285179 CCAGGCACACACGTGCACACGCA No data
Right 1062197983 9:135285170-135285192 TGCACACGCATCCCCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197983 Original CRISPR TGCACACGCATCCCCCACAC AGG Intergenic
No off target data available for this crispr