ID: 1062197988

View in Genome Browser
Species Human (GRCh38)
Location 9:135285199-135285221
Sequence CACACGTGACACGCGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197980_1062197988 21 Left 1062197980 9:135285155-135285177 CCCCAGGCACACACGTGCACACG No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data
1062197986_1062197988 -7 Left 1062197986 9:135285183-135285205 CCCACACAGGCATGTGCACACGT No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data
1062197985_1062197988 -6 Left 1062197985 9:135285182-135285204 CCCCACACAGGCATGTGCACACG No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data
1062197984_1062197988 -5 Left 1062197984 9:135285181-135285203 CCCCCACACAGGCATGTGCACAC No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data
1062197981_1062197988 20 Left 1062197981 9:135285156-135285178 CCCAGGCACACACGTGCACACGC No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data
1062197987_1062197988 -8 Left 1062197987 9:135285184-135285206 CCACACAGGCATGTGCACACGTG No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data
1062197982_1062197988 19 Left 1062197982 9:135285157-135285179 CCAGGCACACACGTGCACACGCA No data
Right 1062197988 9:135285199-135285221 CACACGTGACACGCGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197988 Original CRISPR CACACGTGACACGCGTCCCC AGG Intergenic
No off target data available for this crispr